Skip to main content

Table 2 Primer sequences used in this study

From: Effect of lactate as a peritoneal dialysis fluid buffer on rat peritoneal mesothelial cells

Gene 5′-3′
GAPDH-F CTAGAGACAGCCGCATCTTCTT
GAPDH-R CAATGTCCACTTTGTCACAAGAGA
αSMA-F GATCACCATCGGGAATGAACGC
αSMA-R TGTTATAGGTGGTTTCGTGGATGC
e-cadherin-F GAGAGTCGAGGTGCCTGAGG
e-cadherin-R TCCAAATCCGATACGTGATCTTCTG
MMP2-F GGGACAAGTTCTGGAGATACAATGA
MMP2-R ACTTCACACTCTTCAGACTTTGGT
TGFβ-1-F CCC CACTGATAC GCCTGA GT
TGFβ-1-R CGA AAGCCCTGTATTCCGTCTC
TGFβ-2-F TCAGACACACAACACACCAAAGT
TGFβ-2-R AATGTAGTAGAGGATGGTCAGTGG
bFGF-F GAGAAGAGCGACCCACACG
bFGF-R GTAACACACTTAGAAGCCAGCAG
Collagen type 1-F AGCCTACATGGACCAACAGACT
Collagen type 1-R CAAGTTCCGGTGTGACTCGTG
Collagen type 3-F CTAGAGGATGGCTGCACTAAACAC
Collagen type 3-R TCTATGATGGGGAGTCTCATGGC